Transcript: Human XR_001748539.1

PREDICTED: Homo sapiens M-phase phosphoprotein 9 (MPHOSPH9), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MPHOSPH9 (10198)
Length:
7032
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748539.1
NBCI Gene record:
MPHOSPH9 (10198)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005306 CGAGCTTATTATGAATCAGAA pLKO.1 2085 3UTR 100% 4.950 6.930 N MPHOSPH9 n/a
2 TRCN0000088222 GCCTTGGAAGATCGTTTGGAA pLKO.1 3708 3UTR 100% 3.000 4.200 N Mphosph9 n/a
3 TRCN0000005308 GCCACCGATAACCATGTTAAT pLKO.1 3408 3UTR 100% 13.200 10.560 N MPHOSPH9 n/a
4 TRCN0000421107 ATGAATCTGTTATCCATTATC pLKO_005 742 3UTR 100% 13.200 9.240 N MPHOSPH9 n/a
5 TRCN0000005307 CCTGGTGAATTTGAACATAAT pLKO.1 1056 3UTR 100% 13.200 9.240 N MPHOSPH9 n/a
6 TRCN0000005304 GCTCAGGAATCTCTTGTATAT pLKO.1 3990 3UTR 100% 13.200 9.240 N MPHOSPH9 n/a
7 TRCN0000005305 CGCTAAAGAAATTCCATGTTT pLKO.1 3763 3UTR 100% 5.625 3.938 N MPHOSPH9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02349 pDONR223 99.6% 43.9% None 1_710del;3804_7032del n/a
2 ccsbBroad304_02349 pLX_304 0% 43.9% V5 1_710del;3804_7032del n/a
Download CSV