Transcript: Human XR_001748908.1

PREDICTED: Homo sapiens CASP2 and RIPK1 domain containing adaptor with death domain (CRADD), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CRADD (8738)
Length:
660
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748908.1
NBCI Gene record:
CRADD (8738)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107208 AGGTGACAGATTGACTGGGAT pLKO.1 602 3UTR 100% 2.640 3.696 N CRADD n/a
2 TRCN0000303967 ACAATGCTCCTGCTGGATATC pLKO_005 293 3UTR 100% 10.800 7.560 N CRADD n/a
3 TRCN0000303969 TAGATTCCCTACAGGAGTTTC pLKO_005 351 3UTR 100% 10.800 7.560 N CRADD n/a
4 TRCN0000107206 CCCTAAAGCATTTGATACATT pLKO.1 328 3UTR 100% 5.625 3.938 N CRADD n/a
5 TRCN0000107209 GTACCTCTACCAGGAAGGAAT pLKO.1 217 3UTR 100% 0.000 0.000 N CRADD n/a
6 TRCN0000119881 GACTGGTTCTTCAGTACCTTT pLKO.1 204 3UTR 100% 4.950 3.465 N Cradd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15642 pDONR223 0% 56.9% None (many diffs) n/a
2 ccsbBroad304_15642 pLX_304 0% 56.9% V5 (many diffs) n/a
3 TRCN0000473154 GGAGGCGATCCTGAATTCCGGTTC pLX_317 68.5% 56.9% V5 (many diffs) n/a
Download CSV