Transcript: Human XR_001748938.2

PREDICTED: Homo sapiens ring finger protein 10 (RNF10), transcript variant X11, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF10 (9921)
Length:
3786
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001748938.2
NBCI Gene record:
RNF10 (9921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001748938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033738 CCACTTGTTGAATTTCACTTT pLKO.1 882 3UTR 100% 4.950 3.960 N RNF10 n/a
2 TRCN0000291863 CCACTTGTTGAATTTCACTTT pLKO_005 882 3UTR 100% 4.950 3.960 N RNF10 n/a
3 TRCN0000295647 ATGCATCCTGCACTATCTTTC pLKO_005 1200 3UTR 100% 10.800 7.560 N Rnf10 n/a
4 TRCN0000033734 GCTGAATCTTTACTACCTATT pLKO.1 3294 3UTR 100% 10.800 7.560 N RNF10 n/a
5 TRCN0000291790 GCTGAATCTTTACTACCTATT pLKO_005 3294 3UTR 100% 10.800 7.560 N RNF10 n/a
6 TRCN0000033736 GCCTGTGATGACTTGGAGTTA pLKO.1 1855 3UTR 100% 4.950 3.465 N RNF10 n/a
7 TRCN0000291862 GCCTGTGATGACTTGGAGTTA pLKO_005 1855 3UTR 100% 4.950 3.465 N RNF10 n/a
8 TRCN0000033737 CCTGCTTTATTGAGGCAGCTA pLKO.1 1553 3UTR 100% 2.640 1.848 N RNF10 n/a
9 TRCN0000033735 CCAAGACTACACAGCTCATTT pLKO.1 1038 3UTR 100% 13.200 7.920 N RNF10 n/a
10 TRCN0000291791 CCAAGACTACACAGCTCATTT pLKO_005 1038 3UTR 100% 13.200 7.920 N RNF10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001748938.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07510 pDONR223 100% 61.9% None (many diffs) n/a
2 ccsbBroad304_07510 pLX_304 0% 61.9% V5 (many diffs) n/a
3 TRCN0000467243 AGGGGGGAGTATGCTCTATGCATA pLX_317 14.2% 61.9% V5 (many diffs) n/a
Download CSV