Transcript: Human XR_001749454.2

PREDICTED: Homo sapiens mitochondrial ribosomal protein S31 (MRPS31), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MRPS31 (10240)
Length:
1259
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001749454.2
NBCI Gene record:
MRPS31 (10240)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001749454.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122386 GAGCTTCGGATTCAGTTTGAT pLKO.1 738 3UTR 100% 5.625 3.938 N MRPS31 n/a
2 TRCN0000352901 GAGCTTCGGATTCAGTTTGAT pLKO_005 738 3UTR 100% 5.625 3.938 N MRPS31 n/a
3 TRCN0000139840 CAGGAGAAGACGGATGATCTT pLKO.1 783 3UTR 100% 4.950 3.465 N MRPS31 n/a
4 TRCN0000343332 CAGGAGAAGACGGATGATCTT pLKO_005 783 3UTR 100% 4.950 3.465 N MRPS31 n/a
5 TRCN0000139953 GCTGCGATTATGCTACTCACT pLKO.1 156 3UTR 100% 2.640 1.848 N MRPS31 n/a
6 TRCN0000122602 GCTTCGAAGAGCTACAGAATA pLKO.1 476 3UTR 100% 13.200 7.920 N MRPS31 n/a
7 TRCN0000343376 GCTTCGAAGAGCTACAGAATA pLKO_005 476 3UTR 100% 13.200 7.920 N MRPS31 n/a
8 TRCN0000122356 CTGTTCGAACTGAGGAGACTT pLKO.1 292 3UTR 100% 4.950 2.970 N MRPS31 n/a
9 TRCN0000140253 GAGAAACACCTGGAGAGCTTT pLKO.1 1000 3UTR 100% 4.950 2.970 N MRPS31 n/a
10 TRCN0000144341 CAGATATGAAAGTTGCCAGAT pLKO.1 688 3UTR 100% 4.050 2.430 N MRPS31 n/a
11 TRCN0000144624 GAATGGATTTGAAGAGCTGAT pLKO.1 882 3UTR 100% 4.050 2.430 N MRPS31 n/a
12 TRCN0000140547 GCTAAGCAGTTAGCCACAGTA pLKO.1 844 3UTR 100% 0.495 0.297 N MRPS31 n/a
13 TRCN0000343377 GCTAAGCAGTTAGCCACAGTA pLKO_005 844 3UTR 100% 0.495 0.297 N MRPS31 n/a
14 TRCN0000144054 CCAATTAACAATGAAGCAGGT pLKO.1 937 3UTR 100% 2.160 1.080 Y MRPS31 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001749454.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07575 pDONR223 100% 83.1% None (many diffs) n/a
2 ccsbBroad304_07575 pLX_304 0% 83.1% V5 (many diffs) n/a
3 TRCN0000469448 TTCACCTCGATGGTTTAGATGCCT pLX_317 23.5% 83.1% V5 (many diffs) n/a
Download CSV