Transcript: Human XR_001751307.1

PREDICTED: Homo sapiens CTD small phosphatase like 2 (CTDSPL2), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CTDSPL2 (51496)
Length:
5611
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751307.1
NBCI Gene record:
CTDSPL2 (51496)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000160759 CGGAGTAGAATTGAACGTGAT pLKO.1 409 3UTR 100% 4.050 5.670 N CTDSPL2 n/a
2 TRCN0000158685 GCACACAGATTTAATGGATAA pLKO.1 2851 3UTR 100% 10.800 8.640 N CTDSPL2 n/a
3 TRCN0000216375 GTGTACAAGGAAACTATATAA pLKO.1 1752 3UTR 100% 15.000 10.500 N Ctdspl2 n/a
4 TRCN0000159129 GCTCTCAGTTACAATCAATTT pLKO.1 3042 3UTR 100% 13.200 9.240 N CTDSPL2 n/a
5 TRCN0000160016 CTTTCTAATGGAATCCCTATA pLKO.1 1850 3UTR 100% 10.800 7.560 N CTDSPL2 n/a
6 TRCN0000164548 CCTGGAACGAATGTCTCAGAT pLKO.1 1615 3UTR 100% 4.950 3.465 N CTDSPL2 n/a
7 TRCN0000137355 GAAGAATGAAACCGGCTTGTT pLKO.1 324 3UTR 100% 4.950 3.465 N CTDSPL2 n/a
8 TRCN0000158961 GCTTACTCAAATCAAGCAGTT pLKO.1 793 3UTR 100% 4.050 2.835 N CTDSPL2 n/a
9 TRCN0000134621 GCTTTCTAATGGAATCCCTAT pLKO.1 1849 3UTR 100% 4.050 2.835 N CTDSPL2 n/a
10 TRCN0000136623 GCTTCTAAGAAGGTGTATGCA pLKO.1 1658 3UTR 100% 3.000 2.100 N CTDSPL2 n/a
11 TRCN0000174334 CAGATGTATGAGATCATTCTT pLKO.1 1631 3UTR 100% 5.625 3.375 N Ctdspl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751307.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.