Transcript: Human XR_001751344.2

PREDICTED: Homo sapiens zwilch kinetochore protein (ZWILCH), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZWILCH (55055)
Length:
3243
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751344.2
NBCI Gene record:
ZWILCH (55055)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751344.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000308149 TGCGATCGCTTTGGATATTTC pLKO_005 877 3UTR 100% 13.200 18.480 N ZWILCH n/a
2 TRCN0000072331 CGGAATTAACACTAAACGGTA pLKO.1 1902 3UTR 100% 2.640 3.696 N ZWILCH n/a
3 TRCN0000308152 ACTTGCATCTTTGAATCATTT pLKO_005 1528 3UTR 100% 13.200 9.240 N ZWILCH n/a
4 TRCN0000072328 GCCATGAAATAGAACTTAGTA pLKO.1 2497 3UTR 100% 5.625 3.938 N ZWILCH n/a
5 TRCN0000289548 GCCATGAAATAGAACTTAGTA pLKO_005 2497 3UTR 100% 5.625 3.938 N ZWILCH n/a
6 TRCN0000072332 CAGTTTACTAAGTAAGCTCAT pLKO.1 1381 3UTR 100% 4.050 2.835 N ZWILCH n/a
7 TRCN0000289554 CAGTTTACTAAGTAAGCTCAT pLKO_005 1381 3UTR 100% 4.050 2.835 N ZWILCH n/a
8 TRCN0000191764 GCATCTTTGAATCATTTGGAA pLKO.1 1532 3UTR 100% 3.000 2.100 N Zwilch n/a
9 TRCN0000292584 GCATCTTTGAATCATTTGGAA pLKO_005 1532 3UTR 100% 3.000 2.100 N Zwilch n/a
10 TRCN0000072330 GCTCTTTAAGTCCTCTGCCTT pLKO.1 829 3UTR 100% 2.640 1.848 N ZWILCH n/a
11 TRCN0000072329 CCTGGAAGAAAGGATATTCTT pLKO.1 1924 3UTR 100% 0.563 0.394 N ZWILCH n/a
12 TRCN0000289494 CCTGGAAGAAAGGATATTCTT pLKO_005 1924 3UTR 100% 0.563 0.394 N ZWILCH n/a
13 TRCN0000200765 GCTGAGCTTATCACAACAAAT pLKO.1 665 3UTR 100% 13.200 18.480 N Zwilch n/a
14 TRCN0000292586 GCTGAGCTTATCACAACAAAT pLKO_005 665 3UTR 100% 13.200 18.480 N Zwilch n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751344.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12146 pDONR223 100% 44.1% None 1_550del;1982_3243del n/a
2 ccsbBroad304_12146 pLX_304 0% 44.1% V5 1_550del;1982_3243del n/a
3 TRCN0000477093 AAAGCAGGGGAGCTGCTTGTAGGC pLX_317 28.4% 44.1% V5 1_550del;1982_3243del n/a
Download CSV