Transcript: Human XR_001751908.2

PREDICTED: Homo sapiens N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase (NAGPA), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAGPA (51172)
Length:
2255
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751908.2
NBCI Gene record:
NAGPA (51172)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751908.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000445633 ACGACTTGCTACTGCCCTATC pLKO_005 127 3UTR 100% 6.000 8.400 N NAGPA n/a
2 TRCN0000437479 GCTTGCACTATTCGGCTTCCT pLKO_005 62 3UTR 100% 2.640 3.696 N NAGPA n/a
3 TRCN0000051350 CACAGGAGACAGGTTCCTTTA pLKO.1 697 3UTR 100% 10.800 7.560 N NAGPA n/a
4 TRCN0000437693 CACGTCGCGAAAGCTTGTTTC pLKO_005 1666 3UTR 100% 10.800 7.560 N NAGPA n/a
5 TRCN0000442621 CTTTCATGCAGACGGCCAAAC pLKO_005 785 3UTR 100% 6.000 4.200 N NAGPA n/a
6 TRCN0000440261 ATATCAGCCAGGACGGCCATT pLKO_005 735 3UTR 100% 4.050 2.835 N NAGPA n/a
7 TRCN0000438516 CTCTGCCACCTTTGTGCTCAA pLKO_005 893 3UTR 100% 4.050 2.835 N NAGPA n/a
8 TRCN0000051348 GCTGATTCGTAATGGAAGCAT pLKO.1 638 3UTR 100% 3.000 2.100 N NAGPA n/a
9 TRCN0000447029 CATCAACCTGTGGGAAATGGC pLKO_005 818 3UTR 100% 2.640 1.584 N NAGPA n/a
10 TRCN0000051352 TCTTTCATGCAGACGGCCATA pLKO.1 784 3UTR 100% 4.050 2.835 N NAGPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751908.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11960 pDONR223 100% 40.9% None (many diffs) n/a
2 ccsbBroad304_11960 pLX_304 0% 40.9% V5 (many diffs) n/a
3 TRCN0000472580 TAATCCGCTGGCCGCCTCCCCCTG pLX_317 40.8% 40.9% V5 (many diffs) n/a
Download CSV