Transcript: Human XR_001751991.1

PREDICTED: Homo sapiens activating transcription factor 7 interacting protein 2 (ATF7IP2), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATF7IP2 (80063)
Length:
3625
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751991.1
NBCI Gene record:
ATF7IP2 (80063)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433304 ATGGACCATTCTGTGATATAA pLKO_005 2180 3UTR 100% 15.000 12.000 N ATF7IP2 n/a
2 TRCN0000430583 AGTGTAGTAGAACCAGTATTT pLKO_005 1018 3UTR 100% 13.200 10.560 N ATF7IP2 n/a
3 TRCN0000016034 GCATCCTCATTGGACTCTAAT pLKO.1 480 3UTR 100% 13.200 10.560 N ATF7IP2 n/a
4 TRCN0000424982 TGATTCAGCAGGAGATCTATA pLKO_005 1231 3UTR 100% 13.200 9.240 N ATF7IP2 n/a
5 TRCN0000418873 AGTAATGTTCCAAGCGGTAAT pLKO_005 390 3UTR 100% 10.800 7.560 N ATF7IP2 n/a
6 TRCN0000016037 CCAATTCAGAATCACATGATA pLKO.1 874 3UTR 100% 5.625 3.938 N ATF7IP2 n/a
7 TRCN0000016033 GCCTGTACTTTATCTCAGTTT pLKO.1 2104 3UTR 100% 4.950 3.465 N ATF7IP2 n/a
8 TRCN0000016035 CCCAGTGTATTGAGTGGTGTT pLKO.1 771 3UTR 100% 4.050 2.835 N ATF7IP2 n/a
9 TRCN0000016036 GCTGCTTCAAACTCAAAGGAA pLKO.1 1771 3UTR 100% 3.000 2.100 N ATF7IP2 n/a
10 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 208 3UTR 100% 10.800 5.400 Y MRPS16 n/a
11 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 208 3UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751991.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12668 pDONR223 100% 53.2% None (many diffs) n/a
2 ccsbBroad304_12668 pLX_304 0% 53.2% V5 (many diffs) n/a
3 TRCN0000491708 ATCAATATATCCTCCCGATGCGAG pLX_317 17.7% 53.2% V5 (many diffs) n/a
Download CSV