Transcript: Human XR_001753135.1

PREDICTED: Homo sapiens MALT1 paracaspase (MALT1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MALT1 (10892)
Length:
8815
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753135.1
NBCI Gene record:
MALT1 (10892)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271527 AGGATCAACTGTACCATATTT pLKO_005 4685 3UTR 100% 15.000 21.000 N MALT1 n/a
2 TRCN0000359463 TCACCAGGCATAACCTAATTT pLKO_005 3214 3UTR 100% 15.000 21.000 N MALT1 n/a
3 TRCN0000271478 CCAATGTCATGATCATCTATA pLKO_005 2202 3UTR 100% 13.200 18.480 N MALT1 n/a
4 TRCN0000222552 GCTGAATCTCTTGTGCGGAAT pLKO.1 2087 3UTR 100% 4.050 5.670 N MALT1 n/a
5 TRCN0000073824 CCGGAGATAATAATGTGTGAT pLKO.1 2243 3UTR 100% 4.950 3.960 N MALT1 n/a
6 TRCN0000073826 CTACGATGATACCATTCCAAT pLKO.1 1598 3UTR 100% 4.950 3.960 N MALT1 n/a
7 TRCN0000271530 AGGGAGTATATGGGTTATTAT pLKO_005 1402 3UTR 100% 15.000 10.500 N MALT1 n/a
8 TRCN0000271529 CATCCTGGTAATCCAAGTAAT pLKO_005 2666 3UTR 100% 13.200 9.240 N MALT1 n/a
9 TRCN0000073823 CCAGAAATCTATTCCAGTATT pLKO.1 3295 3UTR 100% 13.200 9.240 N MALT1 n/a
10 TRCN0000271528 TGATGCTCCAAATCCATATAG pLKO_005 1475 3UTR 100% 13.200 9.240 N MALT1 n/a
11 TRCN0000364270 TGATGCTCCAAATCCATATAG pLKO_005 1475 3UTR 100% 13.200 9.240 N Malt1 n/a
12 TRCN0000359387 TGTCGAGTTAATAACAATTTC pLKO_005 792 3UTR 100% 13.200 9.240 N MALT1 n/a
13 TRCN0000359461 TGTACGAATTGACTAACTTAC pLKO_005 1288 3UTR 100% 10.800 7.560 N MALT1 n/a
14 TRCN0000073825 CCTCACTACCAGTGGTTCAAA pLKO.1 990 3UTR 100% 5.625 3.938 N MALT1 n/a
15 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8473 3UTR 100% 5.625 2.813 Y KLHL30 n/a
16 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 7523 3UTR 100% 4.950 2.475 Y ERN2 n/a
17 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 7523 3UTR 100% 4.950 2.475 Y P3H4 n/a
18 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 7523 3UTR 100% 4.950 2.475 Y P3H4 n/a
19 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 7525 3UTR 100% 4.950 2.475 Y CFLAR n/a
20 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 7525 3UTR 100% 4.950 2.475 Y C19orf31 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8473 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753135.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.