Transcript: Human XR_001754242.1

PREDICTED: Homo sapiens gamma-glutamyltransferase 7 (GGT7), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GGT7 (2686)
Length:
2442
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754242.1
NBCI Gene record:
GGT7 (2686)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754242.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021576 TGCTCAGTAAACAGGGATCTT pLKO.1 509 3UTR 100% 4.950 3.960 N GGT7 n/a
2 TRCN0000434331 CAGCAATTACAGCGCCCTTGT pLKO_005 1095 3UTR 100% 4.050 3.240 N GGT7 n/a
3 TRCN0000418129 GAGACCCTGAAGATTGCATTA pLKO_005 1270 3UTR 100% 10.800 7.560 N GGT7 n/a
4 TRCN0000423225 TGGGACCTGATGACTTCATTG pLKO_005 1478 3UTR 100% 10.800 7.560 N GGT7 n/a
5 TRCN0000433945 GAGATCCCGTCTATGATTCTA pLKO_005 1310 3UTR 100% 5.625 3.938 N GGT7 n/a
6 TRCN0000429145 CGTGATGCTGGTACATGACAT pLKO_005 606 3UTR 100% 4.950 3.465 N GGT7 n/a
7 TRCN0000021577 GACGAAATGAGAGCCACCTAA pLKO.1 629 3UTR 100% 4.950 3.465 N GGT7 n/a
8 TRCN0000021578 GCCAGTGGACTACATGAGCAT pLKO.1 93 3UTR 100% 2.640 1.848 N GGT7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754242.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06271 pDONR223 100% 81% None (many diffs) n/a
2 ccsbBroad304_06271 pLX_304 0% 81% V5 (many diffs) n/a
3 TRCN0000478008 CCGTACTCACTGTCGTTAAACCCA pLX_317 11.8% 81% V5 (many diffs) n/a
Download CSV