Transcript: Human XR_001754317.1

PREDICTED: Homo sapiens serine palmitoyltransferase long chain base subunit 3 (SPTLC3), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPTLC3 (55304)
Length:
1497
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754317.1
NBCI Gene record:
SPTLC3 (55304)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431170 GCAAATCATCAGATCACTAAA pLKO_005 1064 3UTR 100% 13.200 18.480 N SPTLC3 n/a
2 TRCN0000133841 CACTTACATGGGATATGGAAT pLKO.1 252 3UTR 100% 4.950 3.465 N SPTLC3 n/a
3 TRCN0000138762 GCAATGGCTCACAAAGCAGAA pLKO.1 119 3UTR 100% 4.050 2.835 N SPTLC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754317.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12203 pDONR223 100% 30.8% None (many diffs) n/a
2 ccsbBroad304_12203 pLX_304 0% 30.8% V5 (many diffs) n/a
3 TRCN0000474829 ACTAAAGTGCGAAGCAAGCCTCCT pLX_317 74.6% 30.8% V5 (many diffs) n/a
Download CSV