Transcript: Human XR_001754350.2

PREDICTED: Homo sapiens Ral GTPase activating protein non-catalytic beta subunit (RALGAPB), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RALGAPB (57148)
Length:
8510
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001754350.2
NBCI Gene record:
RALGAPB (57148)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001754350.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000267145 GAGATTCTGCCAGCTTATTTA pLKO_005 1910 3UTR 100% 15.000 21.000 N Ralgapb n/a
2 TRCN0000275154 AGAATCTTACAGGACATTTAA pLKO_005 5030 3UTR 100% 15.000 10.500 N RALGAPB n/a
3 TRCN0000275101 TTGAGTAACCCAGCTATTATA pLKO_005 1166 3UTR 100% 15.000 10.500 N RALGAPB n/a
4 TRCN0000151551 GCAGCATTTGTTCACTGTAAA pLKO.1 1640 3UTR 100% 13.200 9.240 N RALGAPB n/a
5 TRCN0000285297 GCAGCATTTGTTCACTGTAAA pLKO_005 1640 3UTR 100% 13.200 9.240 N RALGAPB n/a
6 TRCN0000285295 GTCGCACCAATAGTGGTATTA pLKO_005 2463 3UTR 100% 13.200 9.240 N RALGAPB n/a
7 TRCN0000152142 CCCAATCATACAGACAATCTT pLKO.1 4238 3UTR 100% 5.625 3.938 N RALGAPB n/a
8 TRCN0000156117 CCGAGAAACTTGGGAAGTCTT pLKO.1 757 3UTR 100% 4.950 3.465 N RALGAPB n/a
9 TRCN0000152367 CCGCAAGAATTGAATCAGTAT pLKO.1 1235 3UTR 100% 4.950 3.465 N RALGAPB n/a
10 TRCN0000318984 CCGCAAGAATTGAATCAGTAT pLKO_005 1235 3UTR 100% 4.950 3.465 N RALGAPB n/a
11 TRCN0000150848 GCATTTAAAGTTCCCGATGAA pLKO.1 1055 3UTR 100% 4.950 3.465 N RALGAPB n/a
12 TRCN0000151249 GCCAGCTTATTTATCCAGATT pLKO.1 1918 3UTR 100% 4.950 3.465 N RALGAPB n/a
13 TRCN0000166364 CACACACACACACACACACAA pLKO.1 7349 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001754350.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.