Transcript: Human XR_001755220.2

PREDICTED: Homo sapiens small G protein signaling modulator 3 (SGSM3), transcript variant X21, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGSM3 (27352)
Length:
2843
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755220.2
NBCI Gene record:
SGSM3 (27352)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153516 CAACCAGAGTTCTACTACGAT pLKO.1 274 3UTR 100% 3.000 4.200 N SGSM3 n/a
2 TRCN0000157362 CGTGTGTACAAGGAAGAAGGT pLKO.1 307 3UTR 100% 2.640 3.696 N SGSM3 n/a
3 TRCN0000156278 CGATGAGTTTGGTTTCCGTGT pLKO.1 291 3UTR 100% 2.160 3.024 N SGSM3 n/a
4 TRCN0000284728 GAGACTTTGCCTCCGTGTATT pLKO_005 1995 3UTR 100% 13.200 10.560 N SGSM3 n/a
5 TRCN0000272358 CTTCAACACGCTATCGGATAT pLKO_005 1164 3UTR 100% 10.800 8.640 N SGSM3 n/a
6 TRCN0000157634 CCTGTTCGAACATGGACTGAA pLKO.1 1900 3UTR 100% 4.950 3.960 N SGSM3 n/a
7 TRCN0000272355 CTGGCCTCTTTGGTTTATAAA pLKO_005 2796 3UTR 100% 15.000 10.500 N SGSM3 n/a
8 TRCN0000272356 GGAGCTGACTCCAGACTATAG pLKO_005 1533 3UTR 100% 10.800 7.560 N SGSM3 n/a
9 TRCN0000153219 GCATGCACAAATGGATGTGAA pLKO.1 2128 3UTR 100% 4.950 3.465 N SGSM3 n/a
10 TRCN0000156798 GTGAAGAACAGCTCCAACGAT pLKO.1 598 3UTR 100% 3.000 2.100 N SGSM3 n/a
11 TRCN0000150374 CAAACCACAGTTTGTACCAAA pLKO.1 2701 3UTR 100% 0.495 0.347 N SGSM3 n/a
12 TRCN0000272303 CCACCTGGAGTTCACCCATAA pLKO_005 402 3UTR 100% 10.800 6.480 N SGSM3 n/a
13 TRCN0000152013 CAAGAACGACATCATCACAAT pLKO.1 1671 3UTR 100% 4.950 3.465 N SGSM3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755220.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03039 pDONR223 100% 79% None (many diffs) n/a
2 ccsbBroad304_03039 pLX_304 0% 79% V5 (many diffs) n/a
3 TRCN0000470240 AATCAGGGATAGATAGATAACCTT pLX_317 22.5% 79% V5 (many diffs) n/a
Download CSV