Transcript: Human XR_001755695.1

PREDICTED: Homo sapiens phosphate regulating endopeptidase homolog X-linked (PHEX), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHEX (5251)
Length:
6444
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755695.1
NBCI Gene record:
PHEX (5251)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434927 TAACCAGTATAGCAACTATTA pLKO_005 2697 3UTR 100% 13.200 18.480 N PHEX n/a
2 TRCN0000419798 GTCAATGGTGCAATTAGTAAC pLKO_005 2989 3UTR 100% 10.800 15.120 N PHEX n/a
3 TRCN0000047088 CCCGAAGATATGCCAAGCTAT pLKO.1 962 3UTR 100% 4.950 6.930 N PHEX n/a
4 TRCN0000047091 CGTCCTACAAACTCGCAAGTA pLKO.1 2355 3UTR 100% 4.950 6.930 N PHEX n/a
5 TRCN0000047090 GCTGAGATAATGATTCCACAT pLKO.1 1523 3UTR 100% 4.050 5.670 N PHEX n/a
6 TRCN0000430149 TCAAAGTTGTAGGGCTTATAA pLKO_005 3249 3UTR 100% 15.000 10.500 N PHEX n/a
7 TRCN0000047089 GCCCGAGAACAAGTCCAAATT pLKO.1 2941 3UTR 100% 13.200 9.240 N PHEX n/a
8 TRCN0000425038 TGCAACGTTTCGTGGTCAATA pLKO_005 1252 3UTR 100% 13.200 9.240 N PHEX n/a
9 TRCN0000047092 CCAACTATTTGGTGTGGAGAA pLKO.1 1767 3UTR 100% 4.050 2.835 N PHEX n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755695.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01188 pDONR223 100% 34.8% None 1_679del;2082_2242del;3088_6444del n/a
2 ccsbBroad304_01188 pLX_304 0% 34.8% V5 1_679del;2082_2242del;3088_6444del n/a
3 TRCN0000477264 GAGACAGACCGACAGGTCTTATAT pLX_317 10.2% 34.8% V5 1_679del;2082_2242del;3088_6444del n/a
Download CSV