Transcript: Human XR_001755743.1

PREDICTED: Homo sapiens XAGE-4 protein (XAGE-4), misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XAGE-4 (139629)
Length:
328
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001755743.1
NBCI Gene record:
XAGE-4 (139629)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001755743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438510 GGGTGCAGCTGAGATTCAAGT pLKO_005 166 3UTR 100% 4.950 2.475 Y XAGE2 n/a
2 TRCN0000281579 CTGAAAGTCGGGATCCTACAC pLKO_005 122 3UTR 100% 4.050 2.025 Y XAGE1B n/a
3 TRCN0000371132 TGAAAGTCGGGATCCTACACC pLKO_005 123 3UTR 100% 2.640 1.320 Y XAGE1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001755743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05158 pDONR223 100% 89.3% None (many diffs) n/a
2 ccsbBroad304_05158 pLX_304 0% 89.3% V5 (many diffs) n/a
3 TRCN0000467575 TTGCTGCAGTTATCGCAACGATGA pLX_317 100% 89.3% V5 (many diffs) n/a
Download CSV