Transcript: Mouse XR_001778431.1

PREDICTED: Mus musculus CCR4-NOT transcription complex, subunit 1 (Cnot1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cnot1 (234594)
Length:
7747
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778431.1
NBCI Gene record:
Cnot1 (234594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238058 TGGTTAGGAATGATCACATTA pLKO_005 3938 3UTR 100% 13.200 18.480 N Cnot1 n/a
2 TRCN0000238055 TGTTAGAGGCTTACGTTAAAG pLKO_005 4008 3UTR 100% 13.200 18.480 N Cnot1 n/a
3 TRCN0000238056 CAGTTATTTCCAGCGAATATA pLKO_005 2893 3UTR 100% 15.000 12.000 N Cnot1 n/a
4 TRCN0000238054 CAGGCCTGGCACCTCATATTA pLKO_005 4449 3UTR 100% 15.000 10.500 N Cnot1 n/a
5 TRCN0000136340 GCCAAATTGTCTCGAATACTT pLKO.1 2009 3UTR 100% 5.625 3.938 N CNOT1 n/a
6 TRCN0000276068 GCCAAATTGTCTCGAATACTT pLKO_005 2009 3UTR 100% 5.625 3.938 N CNOT1 n/a
7 TRCN0000240024 ACCTTCATTGAGCTGATTAAA pLKO_005 7354 3UTR 100% 15.000 7.500 Y Gm6158 n/a
8 TRCN0000235213 TGGACATGTTAAGCGAAATTA pLKO_005 6836 3UTR 100% 15.000 7.500 Y EG665105 n/a
9 TRCN0000235307 TGGACATGTTAAGCGAAATTA pLKO_005 6836 3UTR 100% 15.000 7.500 Y EG665100 n/a
10 TRCN0000235308 ACCTCGGATCCTCACCAATTT pLKO_005 6864 3UTR 100% 13.200 6.600 Y EG665100 n/a
11 TRCN0000235214 AGTAACCTACAGGTATCTAAT pLKO_005 6973 3UTR 100% 13.200 6.600 Y EG665105 n/a
12 TRCN0000235309 AGTAACCTACAGGTATCTAAT pLKO_005 6973 3UTR 100% 13.200 6.600 Y EG665100 n/a
13 TRCN0000240027 CCGCTGAACCAAGTTCATAAA pLKO_005 7553 3UTR 100% 13.200 6.600 Y Gm6158 n/a
14 TRCN0000235306 GTGATGTGATCCCTCCTAATT pLKO_005 6734 3UTR 100% 13.200 6.600 Y EG665100 n/a
15 TRCN0000240026 GTGGACATGTTAAGCGAAATT pLKO_005 6835 3UTR 100% 13.200 6.600 Y Gm6158 n/a
16 TRCN0000235216 TCCGCTGAACCAAGTTCATAA pLKO_005 7552 3UTR 100% 13.200 6.600 Y EG665105 n/a
17 TRCN0000235212 TCCTTTGTGATTACCATTATG pLKO_005 6707 3UTR 100% 13.200 6.600 Y EG665105 n/a
18 TRCN0000235305 TCCTTTGTGATTACCATTATG pLKO_005 6707 3UTR 100% 13.200 6.600 Y EG665100 n/a
19 TRCN0000235215 CTAGACACTGAGGGCCGATAT pLKO_005 7153 3UTR 100% 10.800 5.400 Y EG665105 n/a
20 TRCN0000240025 TAGACACTGAGGGCCGATATC pLKO_005 7154 3UTR 100% 10.800 5.400 Y Gm6158 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.