Transcript: Mouse XR_001778448.1

PREDICTED: Mus musculus protein kinase N1 (Pkn1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pkn1 (320795)
Length:
6868
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778448.1
NBCI Gene record:
Pkn1 (320795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360337 TGAGGAGCTACGACACCATTT pLKO_005 975 3UTR 100% 10.800 8.640 N Pkn1 n/a
2 TRCN0000012708 GCACATTCATAGCGACGTGTT pLKO.1 2522 3UTR 100% 4.050 3.240 N Pkn1 n/a
3 TRCN0000219693 GGACCTGAAGTTGGACAATTT pLKO.1 2624 3UTR 100% 13.200 9.240 N PKN1 n/a
4 TRCN0000360336 TCCGGCACACTGGAGACATAT pLKO_005 1955 3UTR 100% 13.200 9.240 N Pkn1 n/a
5 TRCN0000360338 ACCCTTCGTGCCTACACTTTC pLKO_005 3074 3UTR 100% 10.800 7.560 N Pkn1 n/a
6 TRCN0000360335 CCTTCCGGGATTTCGACTTTG pLKO_005 3199 3UTR 100% 10.800 7.560 N Pkn1 n/a
7 TRCN0000012709 GCCAGACAGATGAACATAGAT pLKO.1 1843 3UTR 100% 5.625 3.938 N Pkn1 n/a
8 TRCN0000012710 GCAGGACAGTAAGACCAAGAT pLKO.1 831 3UTR 100% 4.950 3.465 N Pkn1 n/a
9 TRCN0000012712 GCCATCAAAGCCTTGAAGAAA pLKO.1 2331 3UTR 100% 5.625 3.375 N Pkn1 n/a
10 TRCN0000001485 AGAACATGATCCAGACCTACA pLKO.1 758 3UTR 100% 4.050 5.670 N PKN1 n/a
11 TRCN0000001484 CTGATGTGTGAGAAGCGGATA pLKO.1 2385 3UTR 100% 4.050 5.670 N PKN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778448.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489129 CGCACAAGAAGGTCTTGTTCACCG pLX_317 12.9% 35.1% V5 (many diffs) n/a
2 TRCN0000488748 CTATGATATAATGGTCTGGCCCTG pLX_317 10.1% 35.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV