Transcript: Mouse XR_001778869.1

PREDICTED: Mus musculus von Willebrand factor A domain containing 3B (Vwa3b), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Vwa3b (70853)
Length:
4619
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778869.1
NBCI Gene record:
Vwa3b (70853)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000198494 GCTTCAGTTGCATGGGCTAAA pLKO.1 770 3UTR 100% 10.800 15.120 N Vwa3b n/a
2 TRCN0000196163 GCAAGGGTATCCAACGAAGAA pLKO.1 3695 3UTR 100% 4.950 6.930 N Vwa3b n/a
3 TRCN0000087240 GTCGTGGATTAGAGGCATCAA pLKO.1 2366 3UTR 100% 4.950 6.930 N Vwa3b n/a
4 TRCN0000184101 CCCGCCATTGTTATAGCACTT pLKO.1 3978 3UTR 100% 4.050 5.670 N Vwa3b n/a
5 TRCN0000215986 CAGCAATAAGATGGTATTAAT pLKO.1 3341 3UTR 100% 15.000 10.500 N Vwa3b n/a
6 TRCN0000216712 CAGGCCATCAAATCCTATGAA pLKO.1 3408 3UTR 100% 5.625 3.938 N Vwa3b n/a
7 TRCN0000087239 GACAAGATCATTCAGTTCATA pLKO.1 2232 3UTR 100% 5.625 3.938 N Vwa3b n/a
8 TRCN0000180518 GCTGAATTGGCCCATTTCATT pLKO.1 3548 3UTR 100% 5.625 3.938 N Vwa3b n/a
9 TRCN0000087238 CCACGTCAAACTCTTTCAGAA pLKO.1 2507 3UTR 100% 4.950 3.465 N Vwa3b n/a
10 TRCN0000180224 CCTGTCTTGCTCAATGATACA pLKO.1 4109 3UTR 100% 4.950 3.465 N Vwa3b n/a
11 TRCN0000215748 GACAAGCAAAGGATTTGACTT pLKO.1 3950 3UTR 100% 4.950 3.465 N Vwa3b n/a
12 TRCN0000087241 GAGCTCTACATGGAGTCCTTA pLKO.1 2730 3UTR 100% 4.950 3.465 N Vwa3b n/a
13 TRCN0000199004 GCATGGGCTAAAGAGCAAGAA pLKO.1 779 3UTR 100% 4.950 3.465 N Vwa3b n/a
14 TRCN0000180379 GTGGCAGCTAACTTTAAGCAA pLKO.1 4477 3UTR 100% 3.000 2.100 N Vwa3b n/a
15 TRCN0000087242 CAGCAACAAAGACAGCTCCAA pLKO.1 3005 3UTR 100% 2.640 1.848 N Vwa3b n/a
16 TRCN0000242976 GCTTGGTCCACGTCAACATTA pLKO_005 2032 3UTR 100% 13.200 18.480 N VWA3B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778869.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.