Transcript: Mouse XR_001779894.1

PREDICTED: Mus musculus zinc finger protein 287 (Zfp287), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp287 (170740)
Length:
5141
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001779894.1
NBCI Gene record:
Zfp287 (170740)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001779894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431071 AGCCCTACGGATGCCGTATAT pLKO_005 2530 3UTR 100% 13.200 18.480 N Zfp287 n/a
2 TRCN0000082191 CCTGTTCAGAAGGAATTGTAT pLKO.1 900 3UTR 100% 5.625 7.875 N Zfp287 n/a
3 TRCN0000082190 GCCATAGTTCATCACTGATTA pLKO.1 1810 3UTR 100% 13.200 10.560 N Zfp287 n/a
4 TRCN0000229721 CATAGTTCATCACTGATTAAT pLKO_005 1812 3UTR 100% 15.000 10.500 N ZNF287 n/a
5 TRCN0000082188 CCAGAAAGAAATACTAGGAAA pLKO.1 2856 3UTR 100% 4.950 3.465 N Zfp287 n/a
6 TRCN0000082189 CCTGAGGTTCATTCCAAGGAA pLKO.1 564 3UTR 100% 3.000 2.100 N Zfp287 n/a
7 TRCN0000429866 AGGTTAGGACTTGGGTAAATT pLKO_005 637 3UTR 100% 15.000 9.000 N Zfp287 n/a
8 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1681 3UTR 100% 13.200 6.600 Y Zfp934 n/a
9 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1681 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
10 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1681 3UTR 100% 13.200 6.600 Y EG668616 n/a
11 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1679 3UTR 100% 4.950 2.475 Y ZNF254 n/a
12 TRCN0000017852 CTTATTCAACACCAGAGGAAA pLKO.1 2496 3UTR 100% 4.950 2.970 N ZNF660 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001779894.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.