Transcript: Mouse XR_001780468.1

PREDICTED: Mus musculus zinc finger protein 410 (Zfp410), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp410 (52708)
Length:
3616
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001780468.1
NBCI Gene record:
Zfp410 (52708)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001780468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375793 CTTGCCAAGAGCAGGTTTAAT pLKO_005 3159 3UTR 100% 15.000 21.000 N Zfp410 n/a
2 TRCN0000219862 CCACTAATGGGCAGTAGTTTG pLKO.1 2152 3UTR 100% 10.800 15.120 N ZNF410 n/a
3 TRCN0000375795 CCACTAATGGGCAGTAGTTTG pLKO_005 2152 3UTR 100% 10.800 15.120 N Zfp410 n/a
4 TRCN0000098142 GACTAATGTTACCAGATGAAA pLKO.1 1172 3UTR 100% 5.625 7.875 N Zfp410 n/a
5 TRCN0000098144 CCGCAGGAGTTACTAAACCAA pLKO.1 2878 3UTR 100% 3.000 4.200 N Zfp410 n/a
6 TRCN0000098140 CCTGAGTAAGACTTAGCCTTT pLKO.1 3378 3UTR 100% 4.050 3.240 N Zfp410 n/a
7 TRCN0000366943 ACAGATCCAAAGGCTCATAAT pLKO_005 2978 3UTR 100% 13.200 9.240 N Zfp410 n/a
8 TRCN0000366944 GAGTCCTTGAATCTATCAAAT pLKO_005 2239 3UTR 100% 13.200 9.240 N Zfp410 n/a
9 TRCN0000375866 TTCTGTCTTAACTGCGGTAAA pLKO_005 2856 3UTR 100% 10.800 7.560 N Zfp410 n/a
10 TRCN0000098143 GCTAAAGACATTACTTGCTTA pLKO.1 1114 3UTR 100% 4.950 3.465 N Zfp410 n/a
11 TRCN0000098141 GCTAGTAGAATCAGAAGCTAA pLKO.1 1098 3UTR 100% 4.950 3.465 N Zfp410 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001780468.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12410 pDONR223 100% 32.5% None (many diffs) n/a
2 ccsbBroad304_12410 pLX_304 0% 32.5% V5 (many diffs) n/a
3 TRCN0000480749 GACCTGTCAGATCCTCCCCACGTC pLX_317 29.1% 32.5% V5 (many diffs) n/a
Download CSV