Transcript: Mouse XR_001781841.1

PREDICTED: Mus musculus Leber congenital amaurosis 5-like (Lca5l), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lca5l (385668)
Length:
2897
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001781841.1
NBCI Gene record:
Lca5l (385668)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001781841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252221 ACATCTATACGAATCGAATAC pLKO_005 1166 3UTR 100% 10.800 15.120 N Lca5l n/a
2 TRCN0000252223 TTCGACAGCTCCTCCGGAAAT pLKO_005 791 3UTR 100% 10.800 15.120 N Lca5l n/a
3 TRCN0000202283 GCGCATAAATTCTGCCAGCAA pLKO.1 2533 3UTR 100% 2.640 2.112 N Lca5l n/a
4 TRCN0000252224 TGGGTGGACTGTGGGTAATTT pLKO_005 2333 3UTR 100% 15.000 10.500 N Lca5l n/a
5 TRCN0000252222 AGCCAATCTCACGGTCTTAAA pLKO_005 1325 3UTR 100% 13.200 9.240 N Lca5l n/a
6 TRCN0000215327 CGAAAGTTTCTTCAACGAAAT pLKO.1 1217 3UTR 100% 10.800 7.560 N Lca5l n/a
7 TRCN0000189967 GCCTGACTTCTCACTATGACT pLKO.1 341 3UTR 100% 3.000 2.100 N Lca5l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001781841.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.