Transcript: Mouse XR_001782121.1

PREDICTED: Mus musculus alpha tubulin acetyltransferase 1 (Atat1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atat1 (73242)
Length:
3847
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782121.1
NBCI Gene record:
Atat1 (73242)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174864 GTGAACAACTTTGTCATCTTT pLKO.1 584 3UTR 100% 5.625 3.938 N Atat1 n/a
2 TRCN0000194424 CCCACAGGTGAACAACTTTGT pLKO.1 577 3UTR 100% 4.950 3.465 N Atat1 n/a
3 TRCN0000174781 GAGACATTAAGCCATACTCTT pLKO.1 735 3UTR 100% 4.950 3.465 N Atat1 n/a
4 TRCN0000175685 GCAGCAGCAAATCATGACTAT pLKO.1 163 3UTR 100% 4.950 3.465 N Atat1 n/a
5 TRCN0000193455 GTTCCTGAATAAGCACTACAA pLKO.1 541 3UTR 100% 4.950 3.465 N Atat1 n/a
6 TRCN0000172948 GAAGGCTTCTTTGCCCATCAA pLKO.1 605 3UTR 100% 4.950 3.465 N ATAT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782121.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10521 pDONR223 100% 12.2% None (many diffs) n/a
2 ccsbBroad304_10521 pLX_304 0% 12.2% V5 (many diffs) n/a
3 TRCN0000466770 CACCAGTATCGGGACTCGTTCTGC pLX_317 71.4% 12.2% V5 (many diffs) n/a
Download CSV