Transcript: Mouse XR_001782331.1

PREDICTED: Mus musculus cerebral cavernous malformation 2-like (Ccm2l), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccm2l (228788)
Length:
4375
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782331.1
NBCI Gene record:
Ccm2l (228788)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000443257 CATTGCTGCTACGAGACTATC pLKO_005 3450 3UTR 100% 10.800 15.120 N Ccm2l n/a
2 TRCN0000201190 GCTAAGAAACTGAAGAGACTT pLKO.1 4162 3UTR 100% 4.950 6.930 N Ccm2l n/a
3 TRCN0000190339 CCTAGAGACCTCTCTTCAATT pLKO.1 4135 3UTR 100% 13.200 9.240 N Ccm2l n/a
4 TRCN0000189517 CCTGCACTCTATGCCTCTTTA pLKO.1 188 3UTR 100% 13.200 9.240 N Ccm2l n/a
5 TRCN0000436024 CCTACTGCAACCTGGTCATTC pLKO_005 958 3UTR 100% 10.800 7.560 N Ccm2l n/a
6 TRCN0000447016 TGTACCTTCTGGGCTTCTTTC pLKO_005 3917 3UTR 100% 10.800 7.560 N Ccm2l n/a
7 TRCN0000166505 CCTGGAGAAAGAGGTCAAGTT pLKO.1 254 3UTR 100% 4.950 3.465 N CCM2L n/a
8 TRCN0000189805 GCCGACATCACTCATGACATT pLKO.1 3749 3UTR 100% 4.950 3.465 N Ccm2l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14387 pDONR223 100% 8.7% None (many diffs) n/a
2 ccsbBroad304_14387 pLX_304 0% 8.7% V5 (many diffs) n/a
3 TRCN0000473762 CCATGGTATTATAGACGTCGGTCT pLX_317 100% 8.7% V5 (many diffs) n/a
Download CSV