Transcript: Mouse XR_001782587.1

PREDICTED: Mus musculus attractin like 1 (Atrnl1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atrnl1 (226255)
Length:
2090
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001782587.1
NBCI Gene record:
Atrnl1 (226255)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001782587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110936 CCGATGAATTATGGGTGTTTA pLKO.1 1533 3UTR 100% 13.200 18.480 N Atrnl1 n/a
2 TRCN0000110938 CCTCTATAAGTACGAAGTCAA pLKO.1 1888 3UTR 100% 4.950 3.960 N Atrnl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001782587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15032 pDONR223 96.6% 58.9% None (many diffs) n/a
2 ccsbBroad304_15032 pLX_304 0% 58.9% V5 (many diffs) n/a
3 TRCN0000466299 GCGAATTAGCAAAAGAGCGTCGAG pLX_317 29.2% 58.9% V5 (many diffs) n/a
Download CSV