Transcript: Mouse XR_001783658.1

PREDICTED: Mus musculus glutamate receptor, ionotropic, AMPA2 (alpha 2) (Gria2), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gria2 (14800)
Length:
4041
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783658.1
NBCI Gene record:
Gria2 (14800)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783658.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000102940 CGTGTTATGACTCCAGAATTT pLKO.1 3586 3UTR 100% 13.200 18.480 N Gria2 n/a
2 TRCN0000061683 CCAGGTTATTACCATTGGAAA pLKO.1 1483 3UTR 100% 4.950 6.930 N GRIA2 n/a
3 TRCN0000102941 CCAATGGGATAAGTTCGCATA pLKO.1 1249 3UTR 100% 4.050 5.670 N Gria2 n/a
4 TRCN0000102944 CCAAACATTGTGGATTCAAGT pLKO.1 2181 3UTR 100% 4.950 3.960 N Gria2 n/a
5 TRCN0000102942 GCCATTCATGAGCCTTGGAAT pLKO.1 2362 3UTR 100% 4.950 3.465 N Gria2 n/a
6 TRCN0000102943 CCTCGCAGAATTCCCAGAATT pLKO.1 3437 3UTR 100% 0.000 0.000 N Gria2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783658.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15434 pDONR223 0% 51.7% None (many diffs) n/a
2 ccsbBroad304_15434 pLX_304 0% 51.7% V5 (many diffs) n/a
3 TRCN0000466239 GCACCCCATCATGTAGGAATTACG pLX_317 14.1% 51.7% V5 (many diffs) n/a
Download CSV