Transcript: Mouse XR_001783690.1

PREDICTED: Mus musculus polyhomeotic-like 3 (Drosophila) (Phc3), transcript variant X9, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Phc3 (241915)
Length:
11145
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783690.1
NBCI Gene record:
Phc3 (241915)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000109014 CCTCATTCTCTAATCAAACAT pLKO.1 1023 3UTR 100% 5.625 4.500 N Phc3 n/a
2 TRCN0000434507 GTGAACATCGGTGACATTAAT pLKO_005 3299 3UTR 100% 15.000 10.500 N Phc3 n/a
3 TRCN0000422051 ATCAAGCATCCACCAGTTAAT pLKO_005 974 3UTR 100% 13.200 9.240 N Phc3 n/a
4 TRCN0000143157 CAAGTCAGTCTCCTACTATAA pLKO.1 1336 3UTR 100% 13.200 9.240 N PHC3 n/a
5 TRCN0000441135 CACAGACTGTTGCGGTAAATC pLKO_005 1816 3UTR 100% 13.200 9.240 N Phc3 n/a
6 TRCN0000423511 CGACATGCTGTTCAGGTAATT pLKO_005 255 3UTR 100% 13.200 9.240 N Phc3 n/a
7 TRCN0000415622 GGAATCGTAAGCCTGATAATC pLKO_005 2665 3UTR 100% 13.200 9.240 N Phc3 n/a
8 TRCN0000109010 GCTACACTGAAAGACTTGTTA pLKO.1 3334 3UTR 100% 5.625 3.938 N Phc3 n/a
9 TRCN0000139438 CCAGTGGAAGACCATCTACAT pLKO.1 436 3UTR 100% 4.950 3.465 N PHC3 n/a
10 TRCN0000139200 CCTTGCAGTCTATGCAGTCTT pLKO.1 1672 3UTR 100% 4.950 3.465 N PHC3 n/a
11 TRCN0000109011 GCAGTGTTACACAACAGTCAA pLKO.1 466 3UTR 100% 4.950 3.465 N Phc3 n/a
12 TRCN0000109013 GCTATTGTGAAACCACAGATT pLKO.1 2274 3UTR 100% 4.950 3.465 N Phc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783690.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15997 pDONR223 0% 3% None (many diffs) n/a
2 ccsbBroad304_15997 pLX_304 0% 3% V5 (many diffs) n/a
3 TRCN0000473121 TTTTTCCGCTAGGGCAAAAGAACA pLX_317 96% 3% V5 (many diffs) n/a
Download CSV