Transcript: Mouse XR_001783700.1

PREDICTED: Mus musculus phosphatidylinositol glycan anchor biosynthesis, class K (Pigk), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pigk (329777)
Length:
2691
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001783700.1
NBCI Gene record:
Pigk (329777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001783700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018421 GCGGTTCTACTCTCCTAACAT pLKO.1 689 3UTR 100% 5.625 7.875 N Pigk n/a
2 TRCN0000279225 GCGGTTCTACTCTCCTAACAT pLKO_005 689 3UTR 100% 5.625 7.875 N Pigk n/a
3 TRCN0000018422 CACACAAATAACTGGGCTGTT pLKO.1 174 3UTR 100% 4.050 5.670 N Pigk n/a
4 TRCN0000279161 CACACAAATAACTGGGCTGTT pLKO_005 174 3UTR 100% 4.050 5.670 N Pigk n/a
5 TRCN0000018423 CCTGCGATTGGAGTTCATCTT pLKO.1 765 3UTR 100% 4.950 3.465 N Pigk n/a
6 TRCN0000279223 CCTGCGATTGGAGTTCATCTT pLKO_005 765 3UTR 100% 4.950 3.465 N Pigk n/a
7 TRCN0000018424 CCACAAGAACATGGAGCTCAA pLKO.1 362 3UTR 100% 4.050 2.835 N Pigk n/a
8 TRCN0000279163 CCACAAGAACATGGAGCTCAA pLKO_005 362 3UTR 100% 4.050 2.835 N Pigk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001783700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11448 pDONR223 100% 31% None (many diffs) n/a
2 ccsbBroad304_11448 pLX_304 0% 31% V5 (many diffs) n/a
3 TRCN0000468670 GCAATACCGTGGGACACTGAGCCT pLX_317 31.7% 31% V5 (many diffs) n/a
Download CSV