Transcript: Mouse XR_001784111.1

PREDICTED: Mus musculus retinoblastoma binding protein 4 (Rbbp4), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbbp4 (19646)
Length:
1857
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784111.1
NBCI Gene record:
Rbbp4 (19646)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110221 CCCACCAGAATTGTTGTTTAT pLKO.1 1225 3UTR 100% 13.200 18.480 N Rbbp4 n/a
2 TRCN0000313825 ATTTGGGACACTCGTTCAAAC pLKO_005 899 3UTR 100% 10.800 15.120 N Rbbp4 n/a
3 TRCN0000110222 GCGGAGAACATTTACAATGAT pLKO.1 1352 3UTR 100% 5.625 7.875 N Rbbp4 n/a
4 TRCN0000317347 GCGGAGAACATTTACAATGAT pLKO_005 1352 3UTR 100% 5.625 7.875 N Rbbp4 n/a
5 TRCN0000313759 CCCTGCATCATTGCAACAAAG pLKO_005 548 3UTR 100% 10.800 7.560 N Rbbp4 n/a
6 TRCN0000313850 GTTAGTCTTTGACCACTATAG pLKO_005 1725 3UTR 100% 10.800 7.560 N Rbbp4 n/a
7 TRCN0000110223 CCTCACAATGAGACTATCTTA pLKO.1 1118 3UTR 100% 5.625 3.938 N Rbbp4 n/a
8 TRCN0000317346 CCTCACAATGAGACTATCTTA pLKO_005 1118 3UTR 100% 5.625 3.938 N Rbbp4 n/a
9 TRCN0000110224 GCATCCCATTATGACAGTGAA pLKO.1 422 3UTR 100% 4.950 3.465 N Rbbp4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784111.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06847 pDONR223 100% 63.2% None (many diffs) n/a
2 ccsbBroad304_06847 pLX_304 0% 63.2% V5 (many diffs) n/a
3 TRCN0000474533 GGCCTAGCATACCTGGTGTTGGAG pLX_317 42.7% 63.2% V5 (many diffs) n/a
Download CSV