Transcript: Mouse XR_001784179.1

PREDICTED: Mus musculus NECAP endocytosis associated 2 (Necap2), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Necap2 (66147)
Length:
1045
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784179.1
NBCI Gene record:
Necap2 (66147)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000125128 AGGTACTTCGTCATCCGAATT pLKO.1 318 3UTR 100% 0.000 0.000 N Necap2 n/a
2 TRCN0000351394 AGGTACTTCGTCATCCGAATT pLKO_005 318 3UTR 100% 0.000 0.000 N Necap2 n/a
3 TRCN0000125126 CTTTGACTTCAACGTGGCATT pLKO.1 398 3UTR 100% 4.050 3.240 N Necap2 n/a
4 TRCN0000351393 CTTTGACTTCAACGTGGCATT pLKO_005 398 3UTR 100% 4.050 3.240 N Necap2 n/a
5 TRCN0000125125 CCAGACCATCAAGATCAACAT pLKO.1 518 3UTR 100% 4.950 3.465 N Necap2 n/a
6 TRCN0000334511 CCAGACCATCAAGATCAACAT pLKO_005 518 3UTR 100% 4.950 3.465 N Necap2 n/a
7 TRCN0000163018 GACCATTTCAAGTGGGTGAAA pLKO.1 423 3UTR 100% 0.495 0.693 N NECAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784179.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03634 pDONR223 100% 65.2% None (many diffs) n/a
2 ccsbBroad304_03634 pLX_304 0% 65.2% V5 (many diffs) n/a
3 TRCN0000478327 GTCCGCCCACGATCCGTCAGTCTC pLX_317 48.9% 65.2% V5 (many diffs) n/a
Download CSV