Transcript: Mouse XR_001784736.1

PREDICTED: Mus musculus TBC1 domain family, member 19 (Tbc1d19), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d19 (67249)
Length:
1394
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001784736.1
NBCI Gene record:
Tbc1d19 (67249)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001784736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000174301 CCCTGAATTGAAAGAATGCTT pLKO.1 755 3UTR 100% 3.000 4.200 N Tbc1d19 n/a
2 TRCN0000175021 GCAAGCAATGATGATTACTAT pLKO.1 1080 3UTR 100% 5.625 4.500 N Tbc1d19 n/a
3 TRCN0000174278 CCTGAGGATATCCTGTATTAT pLKO.1 984 3UTR 100% 15.000 10.500 N Tbc1d19 n/a
4 TRCN0000345579 CCTGAGGATATCCTGTATTAT pLKO_005 984 3UTR 100% 15.000 10.500 N Tbc1d19 n/a
5 TRCN0000345581 GAACGGATGAGCCAGATTTAA pLKO_005 592 3UTR 100% 15.000 10.500 N Tbc1d19 n/a
6 TRCN0000193086 CGAATCACTCAAAGAAGATAT pLKO.1 302 3UTR 100% 13.200 9.240 N Tbc1d19 n/a
7 TRCN0000193212 CCTGAATTGAAAGAATGCTTT pLKO.1 756 3UTR 100% 4.950 3.465 N Tbc1d19 n/a
8 TRCN0000194026 GAGCAGAAAGAGCTTCTCAAT pLKO.1 555 3UTR 100% 4.950 3.465 N Tbc1d19 n/a
9 TRCN0000174762 GAGCTTCTCAATAAGTGGAAT pLKO.1 564 3UTR 100% 4.950 3.465 N Tbc1d19 n/a
10 TRCN0000130773 GCAGCTTAAGACCAATGTGAT pLKO.1 1007 3UTR 100% 4.950 2.970 N TBC1D19 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001784736.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03575 pDONR223 100% 63.7% None (many diffs) n/a
2 ccsbBroad304_03575 pLX_304 0% 63.7% V5 (many diffs) n/a
3 TRCN0000468467 CTCAGGGATCCCTAGTAACATTCT pLX_317 27.5% 63.7% V5 (many diffs) n/a
Download CSV