Transcript: Mouse XR_001785514.1

PREDICTED: Mus musculus transmembrane channel-like gene family 7 (Tmc7), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tmc7 (209760)
Length:
4611
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001785514.1
NBCI Gene record:
Tmc7 (209760)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001785514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427737 GAGGAGACCATCCGCATTTAC pLKO_005 1174 3UTR 100% 13.200 18.480 N Tmc7 n/a
2 TRCN0000068969 CGGCCCATTTACCAACTTCAA pLKO.1 2021 3UTR 100% 4.950 6.930 N Tmc7 n/a
3 TRCN0000438517 GTGCTGAACCTGGTGATATTC pLKO_005 631 3UTR 100% 13.200 9.240 N Tmc7 n/a
4 TRCN0000435275 TACTCACCAAGTACAAGATTA pLKO_005 686 3UTR 100% 13.200 9.240 N Tmc7 n/a
5 TRCN0000423564 AGCGGAGACTAAGGGACATTC pLKO_005 416 3UTR 100% 10.800 7.560 N Tmc7 n/a
6 TRCN0000068971 CCGCAAGTATGCACTGAACAT pLKO.1 387 3UTR 100% 4.950 3.465 N Tmc7 n/a
7 TRCN0000068968 GCCCGAAACTTCTCAACACAT pLKO.1 2323 3UTR 100% 4.950 3.465 N Tmc7 n/a
8 TRCN0000068972 GCTGATGATCTTCGACTTCAT pLKO.1 1608 3UTR 100% 4.950 3.465 N Tmc7 n/a
9 TRCN0000068970 GCTTACTTGATAAGCACGATT pLKO.1 916 3UTR 100% 0.495 0.347 N Tmc7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001785514.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08983 pDONR223 100% 40.1% None (many diffs) n/a
2 ccsbBroad304_08983 pLX_304 0% 40.1% V5 (many diffs) n/a
3 TRCN0000471937 ACCCCCAACCTTGAGAAGCTACAC pLX_317 17.3% 40.1% V5 (many diffs) n/a
Download CSV