Transcript: Human XR_002956419.1

PREDICTED: Homo sapiens HMG-box transcription factor 1 (HBP1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HBP1 (26959)
Length:
1584
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956419.1
NBCI Gene record:
HBP1 (26959)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000015277 GAGTGCCACTTCTCCTAATAA pLKO.1 1335 3UTR 100% 15.000 21.000 N HBP1 n/a
2 TRCN0000015273 CCACTGATGCAGTGCTCATTT pLKO.1 584 3UTR 100% 13.200 10.560 N HBP1 n/a
3 TRCN0000229983 TGAAGAACAGAAACGTTTAAA pLKO_005 1530 3UTR 100% 15.000 10.500 N HBP1 n/a
4 TRCN0000218242 AGTTCATATTGGCGATGTATG pLKO_005 1038 3UTR 100% 10.800 7.560 N HBP1 n/a
5 TRCN0000218961 ATGATTTGGGATGGTGCAATT pLKO_005 810 3UTR 100% 10.800 7.560 N HBP1 n/a
6 TRCN0000015274 CCTCAGACATACCAGAAACTA pLKO.1 498 3UTR 100% 5.625 3.938 N HBP1 n/a
7 TRCN0000084637 CAGAGTTGAATATACTCAGAT pLKO.1 1401 3UTR 100% 4.950 3.465 N Hbp1 n/a
8 TRCN0000331755 CAGAGTTGAATATACTCAGAT pLKO_005 1401 3UTR 100% 4.950 3.465 N Hbp1 n/a
9 TRCN0000015275 GCAAAGGCTTTGGCTGAAGAA pLKO.1 1516 3UTR 100% 4.950 3.465 N HBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956419.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08038 pDONR223 100% 77.9% None (many diffs) n/a
2 ccsbBroad304_08038 pLX_304 0% 77.9% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000473971 TTACTTCAGTTAATACATAATTTT pLX_317 34.9% 77.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV