Transcript: Human XR_002956652.1

PREDICTED: Homo sapiens LON peptidase N-terminal domain and ring finger 1 (LONRF1), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LONRF1 (91694)
Length:
3640
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956652.1
NBCI Gene record:
LONRF1 (91694)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230353 GATATTGCACTGCCGACATTG pLKO_005 2092 3UTR 100% 10.800 15.120 N LONRF1 n/a
2 TRCN0000230355 GCATAGTATAAACCCATTAAG pLKO_005 3326 3UTR 100% 13.200 9.240 N LONRF1 n/a
3 TRCN0000218900 GTTTAGATCATGCACCATATT pLKO_005 1639 3UTR 100% 13.200 9.240 N LONRF1 n/a
4 TRCN0000034060 CCATGTATTTGAGCCAAGATA pLKO.1 1874 3UTR 100% 5.625 3.938 N LONRF1 n/a
5 TRCN0000034062 GAAGATGTTAAGGTTGAGAAT pLKO.1 2121 3UTR 100% 4.950 3.465 N LONRF1 n/a
6 TRCN0000230354 TGACCAAGATACAGCATATAC pLKO_005 2392 3UTR 100% 13.200 7.920 N LONRF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956652.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12968 pDONR223 100% 33% None (many diffs) n/a
2 ccsbBroad304_12968 pLX_304 0% 33% V5 (many diffs) n/a
3 TRCN0000466802 ATGCCCGGGGAGTCGTACGTAAGG pLX_317 22.9% 33% V5 (many diffs) n/a
Download CSV