Transcript: Human XR_002956818.1

PREDICTED: Homo sapiens exosome component 10 (EXOSC10), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EXOSC10 (5394)
Length:
3668
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956818.1
NBCI Gene record:
EXOSC10 (5394)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006341 CGTGGACTCAAACAAGCAATA pLKO.1 1274 3UTR 100% 10.800 15.120 N EXOSC10 n/a
2 TRCN0000315413 ACACCCATTACCTGCTATATA pLKO_005 1357 3UTR 100% 15.000 10.500 N EXOSC10 n/a
3 TRCN0000006340 GCCATCGTTAAGGTCTTTCAT pLKO.1 1116 3UTR 100% 5.625 3.938 N EXOSC10 n/a
4 TRCN0000006339 GCCGACAGCTTTGTGAAGTTT pLKO.1 132 3UTR 100% 5.625 3.938 N EXOSC10 n/a
5 TRCN0000350533 GCCGACAGCTTTGTGAAGTTT pLKO_005 132 3UTR 100% 5.625 3.938 N EXOSC10 n/a
6 TRCN0000006338 GCTGAGAGATTGGAGAATGTT pLKO.1 1833 3UTR 100% 5.625 3.938 N EXOSC10 n/a
7 TRCN0000315412 GCTGAGAGATTGGAGAATGTT pLKO_005 1833 3UTR 100% 5.625 3.938 N EXOSC10 n/a
8 TRCN0000006342 GCATGTCCTTTCCAACTGGAA pLKO.1 3502 3UTR 100% 2.640 1.848 N EXOSC10 n/a
9 TRCN0000350534 GCATGTCCTTTCCAACTGGAA pLKO_005 3502 3UTR 100% 2.640 1.848 N EXOSC10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956818.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14771 pDONR223 0% 72.3% None (many diffs) n/a
2 ccsbBroad304_14771 pLX_304 0% 72.3% V5 (many diffs) n/a
3 TRCN0000472062 CAACTGAAGAGAGTGCCATCAACT pLX_317 13.8% 72.3% V5 (many diffs) n/a
Download CSV