Transcript: Human XR_002956924.1

PREDICTED: Homo sapiens family with sequence similarity 220 member C, pseudogene (FAM220CP), misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM220CP (100507415)
Length:
2616
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002956924.1
NBCI Gene record:
FAM220CP (100507415)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002956924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263693 TTATCACTGGAAATGAGAAAG pLKO_005 1442 3UTR 100% 10.800 5.400 Y FAM220A n/a
2 TRCN0000282763 TTCAGGATGACCCACCAAGTG pLKO_005 1758 3UTR 100% 4.050 2.025 Y FAM220A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002956924.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04423 pDONR223 100% 28.1% None (many diffs) n/a
2 ccsbBroad304_04423 pLX_304 0% 28.1% V5 (many diffs) n/a
3 TRCN0000480810 TCTAAAACGGAGATCCTGACATAT pLX_317 54.2% 28.1% V5 (many diffs) n/a
4 ccsbBroadEn_16044 pDONR223 0% 7.1% None (many diffs) n/a
5 ccsbBroad304_16044 pLX_304 0% 7.1% V5 (many diffs) n/a
6 TRCN0000473741 GCCTTACCCCCCACCTGCTGAATA pLX_317 100% 7.1% V5 (many diffs) n/a
Download CSV