Transcript: Human XR_002957529.1

PREDICTED: Homo sapiens kelch domain containing 1 (KLHDC1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KLHDC1 (122773)
Length:
5255
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957529.1
NBCI Gene record:
KLHDC1 (122773)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144246 CTTATTCACTACTCAGGTCAT pLKO.1 3673 3UTR 100% 4.050 5.670 N KLHDC1 n/a
2 TRCN0000143098 CTTGGATACAGGTCACTGTAA pLKO.1 3626 3UTR 100% 0.495 0.693 N KLHDC1 n/a
3 TRCN0000176830 GATACAGGTCACTGTAATGAT pLKO.1 3630 3UTR 100% 0.563 0.450 N Klhdc1 n/a
4 TRCN0000144247 CCTTACAAACTGCAGAACAAA pLKO.1 4074 3UTR 100% 5.625 3.938 N KLHDC1 n/a
5 TRCN0000144263 CTTCTGCAACAAGTACTCAAA pLKO.1 3759 3UTR 100% 4.950 3.465 N KLHDC1 n/a
6 TRCN0000142174 GCAGCTAATCACCGAGAAGAA pLKO.1 3798 3UTR 100% 4.950 3.465 N KLHDC1 n/a
7 TRCN0000176579 CTACGTGTCTATTGAAGACAA pLKO.1 2823 3UTR 100% 0.495 0.347 N Klhdc1 n/a
8 TRCN0000144643 GAGGATATGATGACAAAGGAT pLKO.1 2987 3UTR 100% 3.000 1.800 N KLHDC1 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 35 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 35 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09473 pDONR223 100% 21.3% None (many diffs) n/a
2 ccsbBroad304_09473 pLX_304 0% 21.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000476132 GGGACGTCCTCTAATCATGACTCG pLX_317 19.9% 21.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV