Transcript: Human XR_002957775.1

PREDICTED: Homo sapiens otoancorin (OTOA), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
OTOA (146183)
Length:
2043
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002957775.1
NBCI Gene record:
OTOA (146183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002957775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430709 ATCATCTTGTCTGCCAAATAC pLKO_005 380 3UTR 100% 13.200 9.240 N OTOA n/a
2 TRCN0000118992 GCGTGGAAATACTGGGAAGTT pLKO.1 914 3UTR 100% 4.950 3.465 N OTOA n/a
3 TRCN0000118994 GCTCTGTTCCTGTATGAGCTT pLKO.1 725 3UTR 100% 2.640 1.848 N OTOA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002957775.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09625 pDONR223 100% 54.7% None (many diffs) n/a
2 ccsbBroad304_09625 pLX_304 0% 54.7% V5 (many diffs) n/a
3 TRCN0000465295 CAGCAGTATATACTTAGGCTTGGT pLX_317 5% 54.7% V5 (many diffs) n/a
Download CSV