Transcript: Human XR_002958047.1

PREDICTED: Homo sapiens ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 (ST6GALNAC1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ST6GALNAC1 (55808)
Length:
2437
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958047.1
NBCI Gene record:
ST6GALNAC1 (55808)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035524 GCTCTCATTAAAGGCTACGAA pLKO.1 1303 3UTR 100% 3.000 4.200 N ST6GALNAC1 n/a
2 TRCN0000035525 CCCAGACTTTCTCCGATACAT pLKO.1 1492 3UTR 100% 5.625 4.500 N ST6GALNAC1 n/a
3 TRCN0000373655 GTGAAATCTTGAAGGTATTAC pLKO_005 2281 3UTR 100% 13.200 9.240 N ST6GALNAC1 n/a
4 TRCN0000373583 CTGACTCTGTGAAGATCAAAG pLKO_005 959 3UTR 100% 10.800 7.560 N ST6GALNAC1 n/a
5 TRCN0000373584 GGACATCCTTCTACGGCTTTA pLKO_005 1340 3UTR 100% 10.800 7.560 N ST6GALNAC1 n/a
6 TRCN0000035528 GCACAGAGAACATTAAAGAAA pLKO.1 260 3UTR 100% 5.625 3.938 N ST6GALNAC1 n/a
7 TRCN0000035526 CCAGAAACTCTTTCTGCCCAA pLKO.1 999 3UTR 100% 0.216 0.151 N ST6GALNAC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958047.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12277 pDONR223 100% 57.7% None (many diffs) n/a
2 ccsbBroad304_12277 pLX_304 0% 57.7% V5 (many diffs) n/a
Download CSV