Transcript: Human XR_002958377.1

PREDICTED: Homo sapiens NSF attachment protein alpha (NAPA), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NAPA (8775)
Length:
2829
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958377.1
NBCI Gene record:
NAPA (8775)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380024 CAAGAGGCCATTAACTGTTTG pLKO_005 424 3UTR 100% 10.800 15.120 N NAPA n/a
2 TRCN0000381191 ACATGGGCCGATTCACGATTG pLKO_005 470 3UTR 100% 6.000 8.400 N NAPA n/a
3 TRCN0000029170 CAGCGCCAAAGACTACTTCTT pLKO.1 732 3UTR 100% 4.950 6.930 N NAPA n/a
4 TRCN0000293265 CAGCGCCAAAGACTACTTCTT pLKO_005 732 3UTR 100% 4.950 6.930 N NAPA n/a
5 TRCN0000382195 TGAGTCATGAGGCCGGTTTCT pLKO_005 2529 3UTR 100% 4.950 6.930 N NAPA n/a
6 TRCN0000380266 TGCGAGCAATCGAGATCTACA pLKO_005 446 3UTR 100% 4.950 6.930 N NAPA n/a
7 TRCN0000293268 TCTTTGATACAGACCTATTTG pLKO_005 2451 3UTR 100% 13.200 9.240 N NAPA n/a
8 TRCN0000293267 ATAGAGGAAGCATGCGAAATC pLKO_005 244 3UTR 100% 10.800 7.560 N NAPA n/a
9 TRCN0000029171 GCTGGCAACGCATTCAAGAAA pLKO.1 394 3UTR 100% 5.625 3.938 N NAPA n/a
10 TRCN0000382210 CACCCTCTGTTCTCGCTACAT pLKO_005 2361 3UTR 100% 4.950 3.465 N NAPA n/a
11 TRCN0000029169 CCGGGAATGCAAGTTGATGAA pLKO.1 2004 3UTR 100% 4.950 3.465 N NAPA n/a
12 TRCN0000293266 CCGGGAATGCAAGTTGATGAA pLKO_005 2004 3UTR 100% 4.950 3.465 N NAPA n/a
13 TRCN0000111543 CGCCAAAGACTACTTCTTCAA pLKO.1 735 3UTR 100% 4.950 3.465 N Napa n/a
14 TRCN0000298396 CGCCAAAGACTACTTCTTCAA pLKO_005 735 3UTR 100% 4.950 3.465 N Napa n/a
15 TRCN0000029173 GTATCAGAAGGCCATTGACAT pLKO.1 663 3UTR 100% 4.950 3.465 N NAPA n/a
16 TRCN0000293264 GTATCAGAAGGCCATTGACAT pLKO_005 663 3UTR 100% 4.950 3.465 N NAPA n/a
17 TRCN0000029172 CTGGCCTCTTTGGAGGCTCAT pLKO.1 218 3UTR 100% 0.135 0.095 N NAPA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958377.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02014 pDONR223 100% 31.2% None 1_132del;797_1954del;2176_2829del n/a
2 ccsbBroad304_02014 pLX_304 0% 31.2% V5 1_132del;797_1954del;2176_2829del n/a
3 TRCN0000472853 CTGTAGACAATTTAGACTTCCTCG pLX_317 46.2% 31.2% V5 1_132del;797_1954del;2176_2829del n/a
Download CSV