Construct: ORF TRCN0000472853
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013145.1_s317c1
- Derived from:
- ccsbBroadEn_02014
- DNA Barcode:
- CTGTAGACAATTTAGACTTCCTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NAPA (8775)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472853
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8775 | NAPA | NSF attachment protein alpha | NM_003827.4 | 100% | 100% | |
| 2 | human | 8775 | NAPA | NSF attachment protein alpha | XM_011527436.1 | 83% | 83% | 0_1ins150 |
| 3 | human | 8775 | NAPA | NSF attachment protein alpha | NR_038456.2 | 67.1% | 1_123del;1009_1318del | |
| 4 | human | 8775 | NAPA | NSF attachment protein alpha | XM_011527437.1 | 64.7% | 64.7% | 0_1ins312 |
| 5 | human | 8775 | NAPA | NSF attachment protein alpha | NR_038457.2 | 41.3% | 1_123del;220_221ins197;812_1465del | |
| 6 | human | 8775 | NAPA | NSF attachment protein alpha | XR_002958377.1 | 31.2% | 1_132del;797_1954del;2176_2829del | |
| 7 | mouse | 108124 | Napa | N-ethylmaleimide sensitive ... | NM_025898.3 | 90.5% | 98.3% | (many diffs) |
| 8 | mouse | 108124 | Napa | N-ethylmaleimide sensitive ... | XM_006539460.2 | 66.8% | 58.6% | (many diffs) |
| 9 | mouse | 108124 | Napa | N-ethylmaleimide sensitive ... | XR_001785464.1 | 35.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 951
- ORF length:
- 885
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga caattccggg aaggaagcgg aggcgatggc gctgttggcc gaggcggagc 121 gcaaagtgaa gaactcgcag tccttcttct ctggcctctt tggaggctca tccaaaatag 181 aggaagcatg cgaaatctac gccagagcag caaacatgtt caaaatggcc aaaaactgga 241 gtgctgctgg aaacgcgttc tgccaggctg cacagctgca cctgcagctc cagagcaagc 301 acgacgcagc cacctgcttt gtggacgctg gcaacgcatt caagaaagcc gacccccaag 361 aggccattaa ctgtttgatg cgagcaatcg agatctacac agacatgggc cgattcacga 421 ttgcggccaa gcaccacatc tccattgctg agatctatga gacagagttg gtggacatcg 481 agaaggccat tgcccactac gagcagtctg cagactacta caaaggcgag gagtccaaca 541 gcTCAGCCAA CAAGTGTCTG CTGAAGGTGG CTGGTTACGC TGCGCTGCTG GAGCAGTATC 601 AGAAGGCCAT TGACATCTAC GAACAGGTGG GGACCAATGC CATGGACAGC CCCCTCCTCA 661 AGTACAGCGC CAAAGACTAC TTCTTCAAGG CGGCCCTCTG CCACTTCTGC ATCGACATGC 721 TCAACGCCAA GCTGGCTGTC CAAAAGTATG AGGAGCTGTT CCCAGCTTTC TCTGATTCCC 781 GGGAATGCAA GTTGATGAAA AAATTGCTAG AGGCCCACGA GGAGCAGAAT GTGGACAGCT 841 ACACCGAGTC GGTGAAGGAA TACGACTCCA TCTCCCGGCT GGACCAGTGG CTCACCACCA 901 TGCTGCTGCG CATCAAGAAG ACCATCCAGG GCGATGAGGA GGACCTGCGC TACCCAACTT 961 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1021 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1081 CTTGTGGAAA GGACGACTGT AGACAATTTA GACTTCCTCG ACGCGTTAAG TCgacaatca 1141 acctctggat tacaaaattt gtgaaagatt