Transcript: Human XR_002958502.1

PREDICTED: Homo sapiens N-terminal EF-hand calcium binding protein 3 (NECAB3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NECAB3 (63941)
Length:
2671
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958502.1
NBCI Gene record:
NECAB3 (63941)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054079 CCGACAATTTAGAAACAGAAA pLKO.1 336 3UTR 100% 4.950 6.930 N NECAB3 n/a
2 TRCN0000442564 AGGAACTGTTCAGCGGCATTG pLKO_005 303 3UTR 100% 6.000 4.800 N NECAB3 n/a
3 TRCN0000054078 GCTGCTTGCTTTCTATTTATT pLKO.1 2080 3UTR 100% 15.000 10.500 N NECAB3 n/a
4 TRCN0000443720 TTCAGCCTCCAAGCTACTTTG pLKO_005 2138 3UTR 100% 10.800 7.560 N NECAB3 n/a
5 TRCN0000054080 GCCTCCAAAGTGGACCAGTTT pLKO.1 476 3UTR 100% 4.950 3.465 N NECAB3 n/a
6 TRCN0000441323 GGTGGATAATGAATAACAACT pLKO_005 1907 3UTR 100% 4.950 3.465 N NECAB3 n/a
7 TRCN0000054081 CTGTATGAGTTCTGGCAGGAT pLKO.1 1771 3UTR 100% 2.640 1.848 N NECAB3 n/a
8 TRCN0000054082 CGCAGAGCAGACAAGAATGAT pLKO.1 212 3UTR 100% 5.625 3.375 N NECAB3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958502.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14241 pDONR223 100% 40.3% None (many diffs) n/a
2 ccsbBroad304_14241 pLX_304 0% 40.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000481233 CCATCTCGTGTCTATCCTCCGCCG pLX_317 35.6% 40.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV