Transcript: Human XR_002958713.1

PREDICTED: Homo sapiens TraB domain containing (TRABD), transcript variant X17, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TRABD (80305)
Length:
2422
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958713.1
NBCI Gene record:
TRABD (80305)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000184393 CGACGTCTACCTAACCTACAT pLKO.1 918 3UTR 100% 4.950 6.930 N TRABD n/a
2 TRCN0000275696 GACGTCTACCTAACCTACATG pLKO_005 919 3UTR 100% 4.950 6.930 N TRABD n/a
3 TRCN0000182929 CCACCCAAATAAAGGATTATT pLKO.1 1512 3UTR 100% 1.500 2.100 N TRABD n/a
4 TRCN0000148862 CCTTAAATCCAAAGGGAGAGA pLKO.1 1983 3UTR 100% 2.640 2.112 N TRABD n/a
5 TRCN0000275621 CCTTAAATCCAAAGGGAGAGA pLKO_005 1983 3UTR 100% 2.640 2.112 N TRABD n/a
6 TRCN0000275622 AGATGATGGCCGAGATGATTG pLKO_005 857 3UTR 100% 10.800 7.560 N TRABD n/a
7 TRCN0000149058 GCCCACCCAAATAAAGGATTA pLKO.1 1510 3UTR 100% 10.800 7.560 N TRABD n/a
8 TRCN0000275703 GCCCACCCAAATAAAGGATTA pLKO_005 1510 3UTR 100% 10.800 7.560 N TRABD n/a
9 TRCN0000122581 CTGCCAATATCGTGTGTCCAT pLKO.1 462 3UTR 100% 2.640 1.848 N TRABD n/a
10 TRCN0000122366 CGCTGCAAGCAGAAGGACCTA pLKO.1 829 3UTR 100% 0.880 0.616 N TRABD n/a
11 TRCN0000275620 CGCTGCAAGCAGAAGGACCTA pLKO_005 829 3UTR 100% 0.880 0.616 N TRABD n/a
12 TRCN0000251034 AGTTCAGGGAGGCCTTCAAAG pLKO_005 650 3UTR 100% 10.800 7.560 N Trabd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958713.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12690 pDONR223 100% 40.8% None (many diffs) n/a
2 ccsbBroad304_12690 pLX_304 0% 40.8% V5 (many diffs) n/a
3 TRCN0000481519 TAATGAGTTTGACGAACTTCATAA pLX_317 33.6% 40.8% V5 (many diffs) n/a
Download CSV