Transcript: Human XR_002959145.1

PREDICTED: Homo sapiens uncharacterized LOC112268389 (LOC112268389), transcript variant X8, ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC112268389 (112268389)
Length:
3706
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959145.1
NBCI Gene record:
LOC112268389 (112268389)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000187378 CCCAAATGTGGGAGTTAACTT pLKO.1 2402 3UTR 100% 5.625 2.813 Y LINC00965 n/a
2 TRCN0000187059 CAAATGTGGGAGTTAACTTCA pLKO.1 2404 3UTR 100% 4.950 2.475 Y LINC00965 n/a
3 TRCN0000203723 CATCCCAAATGTGGGAGTTAA pLKO.1 2399 3UTR 100% 1.320 0.660 Y LINC00965 n/a
4 TRCN0000204835 GTACATCCCAAATGTGGGAGT pLKO.1 2396 3UTR 100% 0.216 0.108 Y LINC00965 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959145.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10618 pDONR223 100% 7% None (many diffs) n/a
2 ccsbBroad304_10618 pLX_304 0% 7% V5 (many diffs) n/a
3 TRCN0000476141 GCCGAACCGGTTGTTCTTGATCTC pLX_317 100% 7% V5 (many diffs) n/a
Download CSV