Transcript: Human XR_002959287.1

PREDICTED: Homo sapiens target of EGR1, exonuclease (TOE1), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOE1 (114034)
Length:
2501
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959287.1
NBCI Gene record:
TOE1 (114034)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151587 GATGCCTTTATGACAGGTTAT pLKO.1 2024 3UTR 100% 10.800 15.120 N TOE1 n/a
2 TRCN0000427713 GGCATTTATGACACCAAATAT pLKO_005 1262 3UTR 100% 15.000 10.500 N TOE1 n/a
3 TRCN0000430710 GAATGCCACAATAAGGTATAT pLKO_005 2108 3UTR 100% 13.200 9.240 N TOE1 n/a
4 TRCN0000421059 GTGCTACACAATGGCCTTATA pLKO_005 1151 3UTR 100% 13.200 9.240 N TOE1 n/a
5 TRCN0000150717 CTAGCCATAAAGACAGCTAAT pLKO.1 659 3UTR 100% 10.800 7.560 N TOE1 n/a
6 TRCN0000416060 GGGTCTCTCTAGCCTGAAATG pLKO_005 2272 3UTR 100% 10.800 7.560 N TOE1 n/a
7 TRCN0000151849 CCTTATCATTGACACTGATGA pLKO.1 1663 3UTR 100% 4.950 3.465 N TOE1 n/a
8 TRCN0000152877 GAACATTCCTATCTGGCTCAA pLKO.1 926 3UTR 100% 4.050 2.835 N TOE1 n/a
9 TRCN0000155380 CCTACCATAAGGGCAATGACA pLKO.1 1059 3UTR 100% 3.000 2.100 N TOE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959287.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487726 GTCGCGGCATACTTTTCTTTACAG pLX_317 18.4% 61.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV