Transcript: Human XR_002959315.1

PREDICTED: Homo sapiens sphingomyelin phosphodiesterase 4 (SMPD4), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SMPD4 (55627)
Length:
1620
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959315.1
NBCI Gene record:
SMPD4 (55627)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245616 AGTGCCAAGACTTGGTTAAAG pLKO_005 524 3UTR 100% 13.200 7.920 N SMPD4 n/a
2 TRCN0000245618 CCCTGAATCCGTTCGAGTATT pLKO_005 890 3UTR 100% 13.200 7.920 N SMPD4 n/a
3 TRCN0000172804 GCAGTGCCAAGACTTGGTTAA pLKO.1 522 3UTR 100% 10.800 6.480 N SMPD4 n/a
4 TRCN0000245620 CCTGAAAGCTGACTCTATAAA pLKO_005 486 3UTR 100% 15.000 7.500 Y SMPD4 n/a
5 TRCN0000245617 ACTTCAGACTGTGCCTATTTC pLKO_005 976 3UTR 100% 13.200 6.600 Y SMPD4 n/a
6 TRCN0000124165 GCCTGAAAGCTGACTCTATAA pLKO.1 485 3UTR 100% 13.200 6.600 Y Smpd4 n/a
7 TRCN0000331603 GCCTGAAAGCTGACTCTATAA pLKO_005 485 3UTR 100% 13.200 6.600 Y Smpd4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959315.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12238 pDONR223 100% 27.2% None (many diffs) n/a
2 ccsbBroad304_12238 pLX_304 0% 27.2% V5 (many diffs) n/a
3 TRCN0000477592 CCTTTCAAACCCGATGTTAGGCCA pLX_317 5% 27.2% V5 (many diffs) n/a
Download CSV