Transcript: Human XR_002959605.1

PREDICTED: Homo sapiens solute carrier family 33 member 1 (SLC33A1), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC33A1 (9197)
Length:
4784
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959605.1
NBCI Gene record:
SLC33A1 (9197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310223 GGACTCTTCATGATCTATTTA pLKO_005 1815 3UTR 100% 15.000 21.000 N SLC33A1 n/a
2 TRCN0000296497 TACAGCCCTGGATGGTTATTA pLKO_005 2956 3UTR 100% 15.000 21.000 N SLC33A1 n/a
3 TRCN0000042922 CTGCTGAGTTATGCTTTACAT pLKO.1 2687 3UTR 100% 5.625 7.875 N SLC33A1 n/a
4 TRCN0000042920 GAATCGTTACTCTTTCAGATT pLKO.1 2119 3UTR 100% 4.950 6.930 N SLC33A1 n/a
5 TRCN0000289985 GAATCGTTACTCTTTCAGATT pLKO_005 2119 3UTR 100% 4.950 6.930 N SLC33A1 n/a
6 TRCN0000310222 ATCAGTGCACAGGAGTATAAA pLKO_005 3161 3UTR 100% 15.000 10.500 N SLC33A1 n/a
7 TRCN0000296496 AGGTTAGTGATCCACTTATTG pLKO_005 2757 3UTR 100% 13.200 9.240 N SLC33A1 n/a
8 TRCN0000042918 GCCTCTGATTATCAGCAAATA pLKO.1 2250 3UTR 100% 13.200 9.240 N SLC33A1 n/a
9 TRCN0000042921 CTACTCTTTCTTTACGTGCTT pLKO.1 1593 3UTR 100% 2.640 1.848 N SLC33A1 n/a
10 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 161 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959605.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02104 pDONR223 100% 29.3% None (many diffs) n/a
2 ccsbBroad304_02104 pLX_304 0% 29.3% V5 (many diffs) n/a
3 TRCN0000474996 TTTTATCCTGCCAGCTCTTGTGTT pLX_317 3.7% 29.3% V5 (many diffs) n/a
Download CSV