Transcript: Human XR_002959720.1

PREDICTED: Homo sapiens RUN and FYVE domain containing 3 (RUFY3), transcript variant X20, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RUFY3 (22902)
Length:
6137
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002959720.1
NBCI Gene record:
RUFY3 (22902)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002959720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000130334 GACGGTCAGATTACTGCAATT pLKO.1 1372 3UTR 100% 10.800 15.120 N RUFY3 n/a
2 TRCN0000447405 GTCACGTCGCAAGTCCGATAT pLKO_005 2037 3UTR 100% 10.800 15.120 N RUFY3 n/a
3 TRCN0000413280 TACGATTGGATGTTGAGAAAG pLKO_005 1676 3UTR 100% 10.800 15.120 N RUFY3 n/a
4 TRCN0000129998 GCTGCTACCATTAAACAACTT pLKO.1 1921 3UTR 100% 4.950 6.930 N RUFY3 n/a
5 TRCN0000129032 GAACTAAACAGTCGCTTGGAA pLKO.1 1882 3UTR 100% 3.000 4.200 N RUFY3 n/a
6 TRCN0000426833 CAAGCATGAACTTGCCTTTAA pLKO_005 1824 3UTR 100% 13.200 9.240 N RUFY3 n/a
7 TRCN0000430811 CATTTAAGCTCTGATTCTATA pLKO_005 2098 3UTR 100% 13.200 9.240 N RUFY3 n/a
8 TRCN0000127915 CCTGGCTTCGTTTGGCATTAA pLKO.1 1106 3UTR 100% 13.200 9.240 N RUFY3 n/a
9 TRCN0000120984 CCTTAAATAGTGCAGCAAATA pLKO.1 1979 3UTR 100% 13.200 9.240 N Rufy3 n/a
10 TRCN0000417785 GAGTTCAGACTTAGGAGTAAA pLKO_005 1851 3UTR 100% 13.200 9.240 N RUFY3 n/a
11 TRCN0000421501 TTGCAAACAACAGGATCATTA pLKO_005 1514 3UTR 100% 13.200 9.240 N RUFY3 n/a
12 TRCN0000430128 ACCTTAAATAGTGCAGCAAAT pLKO_005 1978 3UTR 100% 10.800 7.560 N RUFY3 n/a
13 TRCN0000438447 AGGACGGGAACAGCAGTAAAG pLKO_005 1340 3UTR 100% 10.800 7.560 N RUFY3 n/a
14 TRCN0000130549 GCTTGATTGAATCAGCTCTGA pLKO.1 857 3UTR 100% 2.640 1.584 N RUFY3 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5044 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 5209 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002959720.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.