Transcript: Mouse XR_003952489.1

PREDICTED: Mus musculus aldehyde dehydrogenase family 7, member A1 (Aldh7a1), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Aldh7a1 (110695)
Length:
4064
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_003952489.1
NBCI Gene record:
Aldh7a1 (110695)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_003952489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042076 CGGAGAAATAGTCAGAAAGAT pLKO.1 650 3UTR 100% 5.625 3.938 N Aldh7a1 n/a
2 TRCN0000308498 CGGAGAAATAGTCAGAAAGAT pLKO_005 650 3UTR 100% 5.625 3.938 N Aldh7a1 n/a
3 TRCN0000042074 CCCAATCCTCTATGTCTTCAA pLKO.1 1503 3UTR 100% 4.950 3.465 N Aldh7a1 n/a
4 TRCN0000308582 CCCAATCCTCTATGTCTTCAA pLKO_005 1503 3UTR 100% 4.950 3.465 N Aldh7a1 n/a
5 TRCN0000042073 GCTCTCATCGAAATGTGGAAT pLKO.1 849 3UTR 100% 4.950 3.465 N Aldh7a1 n/a
6 TRCN0000308512 GCTCTCATCGAAATGTGGAAT pLKO_005 849 3UTR 100% 4.950 3.465 N Aldh7a1 n/a
7 TRCN0000042075 GTGCCATTTGTTCCCTGGTTT pLKO.1 1054 3UTR 100% 4.950 3.465 N Aldh7a1 n/a
8 TRCN0000308510 GTGCCATTTGTTCCCTGGTTT pLKO_005 1054 3UTR 100% 4.950 3.465 N Aldh7a1 n/a
9 TRCN0000042077 GCTTGGAGGAAACAATGCCAT pLKO.1 1208 3UTR 100% 2.640 1.848 N Aldh7a1 n/a
10 TRCN0000308511 GCTTGGAGGAAACAATGCCAT pLKO_005 1208 3UTR 100% 2.640 1.848 N Aldh7a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_003952489.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.