Transcript: Human XR_242077.2

PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein A2/B1 (HNRNPA2B1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HNRNPA2B1 (3181)
Length:
1895
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_242077.2
NBCI Gene record:
HNRNPA2B1 (3181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_242077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314506 TGATACCATTGAGATAATTAC pLKO_005 612 3UTR 100% 13.200 9.240 N HNRNPA2B1 n/a
2 TRCN0000377202 GTGGAAGAGGAGGCAACTTTG pLKO_005 800 3UTR 100% 10.800 7.560 N HNRNPA2B1 n/a
3 TRCN0000314507 TATGGCAGTGGACGTGGATTT pLKO_005 898 3UTR 100% 10.800 7.560 N HNRNPA2B1 n/a
4 TRCN0000001059 CAGAAATACCATACCATCAAT pLKO.1 712 3UTR 100% 5.625 3.938 N HNRNPA2B1 n/a
5 TRCN0000314561 CAGAAATACCATACCATCAAT pLKO_005 712 3UTR 100% 5.625 3.938 N HNRNPA2B1 n/a
6 TRCN0000001060 AGACAAGAAATGCAGGAAGTT pLKO.1 766 3UTR 100% 4.950 3.465 N HNRNPA2B1 n/a
7 TRCN0000001061 TGACAACTATGGAGGAGGAAA pLKO.1 1059 3UTR 100% 4.950 3.465 N HNRNPA2B1 n/a
8 TRCN0000071140 GAGGAAATTATGGAAGTGGAA pLKO.1 1073 3UTR 100% 2.640 1.848 N Hnrnpa2b1 n/a
9 TRCN0000001058 GCTTCTTCCTATTTGCCATGG pLKO.1 1261 3UTR 100% 2.250 1.575 N HNRNPA2B1 n/a
10 TRCN0000010582 AGAAGCTGTTTGTTGGCGGAA pLKO.1 533 3UTR 100% 2.160 1.512 N HNRNPA2B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_242077.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10887 pDONR223 100% 39.3% None (many diffs) n/a
2 ccsbBroad304_10887 pLX_304 0% 39.3% V5 (many diffs) n/a
3 TRCN0000474018 ACTCTAGCTTGTGTGCCCCAGACG pLX_317 17.6% 39.3% V5 (many diffs) n/a
Download CSV