Transcript: Human XR_243270.2

PREDICTED: Homo sapiens serine/arginine repetitive matrix 2 (SRRM2), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SRRM2 (23524)
Length:
11269
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_243270.2
NBCI Gene record:
SRRM2 (23524)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_243270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314504 GTTGGGACTGGAGGTTGTATA pLKO_005 11075 3UTR 100% 13.200 18.480 N SRRM2 n/a
2 TRCN0000000176 CGCCACCTAAACAGAAATCTA pLKO.1 4437 3UTR 100% 5.625 7.875 N SRRM2 n/a
3 TRCN0000130685 CGCCACCTAAACAGAAATCTA pLKO.1 4437 3UTR 100% 5.625 7.875 N SRRM2 n/a
4 TRCN0000314502 CGCCACCTAAACAGAAATCTA pLKO_005 4437 3UTR 100% 5.625 7.875 N SRRM2 n/a
5 TRCN0000127614 CCGTTTCTTAATCAGCTGGAA pLKO.1 6047 3UTR 100% 2.640 3.696 N SRRM2 n/a
6 TRCN0000350298 CCGTTTCTTAATCAGCTGGAA pLKO_005 6047 3UTR 100% 2.640 3.696 N SRRM2 n/a
7 TRCN0000000177 CCCAAAGTGAAGGCAATAATA pLKO.1 4724 3UTR 100% 15.000 10.500 N SRRM2 n/a
8 TRCN0000314562 CCCAAAGTGAAGGCAATAATA pLKO_005 4724 3UTR 100% 15.000 10.500 N SRRM2 n/a
9 TRCN0000130209 CCCAACCTAAAGCTAAATCTA pLKO.1 4380 3UTR 100% 5.625 3.938 N SRRM2 n/a
10 TRCN0000130672 CATCTCCAGTAACTCGAAGAA pLKO.1 7968 3UTR 100% 4.950 3.465 N SRRM2 n/a
11 TRCN0000128070 GCTGTGTCTTTGACTCTTGAT pLKO.1 5810 3UTR 100% 4.950 3.465 N SRRM2 n/a
12 TRCN0000000175 CTGGAGGTTGTATAAGGTGTT pLKO.1 11082 3UTR 100% 4.050 2.835 N SRRM2 n/a
13 TRCN0000000178 GAAGAGTTAATGGAGGTGGTA pLKO.1 5681 3UTR 100% 2.640 1.848 N SRRM2 n/a
14 TRCN0000130321 GCCCTTATGAAGACAAAGATA pLKO.1 2973 3UTR 100% 5.625 3.375 N SRRM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_243270.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.